The replisome is a complex molecular machine that carries out replication of DNA. The replisome first unwinds double stranded DNA into two single strands. For each of the resulting single strands, a new complementary sequence of DNA is synthesized. The total result is formation of two new double stranded DNA sequences that are exact copies of the original double stranded DNA sequence.
In terms of structure, the replisome is composed of two replicative polymerase complexes, one of which synthesizes the leading strand, while the other synthesizes the lagging strand. The replisome is composed of a number of proteins including helicase, RFC, PCNA, gyrase/topoisomerase, SSB/RPA, primase, DNA polymerase III, RNAse H, and DNA ligase.
Overview of prokaryotic DNA replication process
For prokaryotes, each dividing nucleoid (region containing genetic material which is not a nucleus) requires two replisomes for bidirectional replication. The two replisomes continue replication at both forks in the middle of the cell. Finally, as the termination site replicates, the two replisomes separate from the DNA. The replisome remains at a fixed, midcell location in the cell, attached to the membrane, and the template DNA threads through it. DNA is fed through the stationary pair of replisomes located at the cell membrane.
Overview of eukaryotic DNA replication process
For eukaryotes, numerous replication bubbles form at origins of replication throughout the chromosome. As with prokaryotes, two replisomes are required, one at each replication fork located at the terminus of the replication bubble. Because of significant differences in chromosome size, and the associated complexities of highly condensed chromosomes, various aspects of the DNA replication process in eukaryotes, including the terminal phases, are less well-characterised than for prokaryotes.
Challenges of DNA replication
The replisome is a system in which various factors work together to solve the structural and chemical challenges of DNA replication. Chromosome size and structure varies between organisms, but since DNA molecules are the reservoir of genetic information for all forms of life, many replication challenges and solutions are the same for different organisms. As a result, the replication factors that solve these problems are highly conserved in terms of structure, chemistry, functionality, or sequence. General structural and chemical challenges include the following:
Efficient replisome assembly at origins of replication (origin recognition complexes or specific replication origin sequences in some organisms) Separating the duplex into the leading and lagging template strands (helicases) Protecting the leading and lagging strands from damage after duplex separation (SSB and RPA factors) Priming of the leading and lagging template strands (primase or DNA polymerase alpha) Ensuring processivity (clamp loading factors, ring-shaped clamp proteins, strand binding proteins) High-fidelity DNA replication (DNA polymerase III, DNA polymerase delta, DNA polymerase epsilon. All have intrinsically low error rates because of their structure and chemistry.) Error correction (replicative polymerase active sites sense errors; 3' to 5' exonuclease domains of replicative polymerases fix errors) Synchronised polymerisation of leading and lagging strands despite anti-parallel structure (replication fork structure, dimerisation of replicative polymerases) Primer removal (DNA polymerase I, RNAse H, flap endonucleases such as FEN1, or other DNA repair factors) Formation of phosphodiester bonds at gaps between Okazaki fragments (ligase)
In general, the challenges of DNA replication involve the structure of the molecules, the chemistry of the molecules, and, from a systems perspective, the underlying relationships between the structure and the chemistry.
Solving the challenges of DNA replication
Many of the structural and chemical problems associated with DNA replication are managed by molecular machinery that is highly conserved across organisms. This section discusses how replisome factors solve the structural and chemical challenges of DNA replication.
Replisome assembly
DNA replication begins at sites called origins of replication. In organisms with small genomes and simple chromosome structure, such as bacteria, there may be only a few origins of replication on each chromosome. Organisms with large genomes and complex chromosome structure, such as humans, may have hundreds, or even thousands, of origins of replication spread across multiple chromosomes.
DNA structure varies with time, space, and sequence, and it is thought that these variations, in addition to their role in gene expression, also play active roles in replisome assembly during DNA synthesis. Replisome assembly at an origin of replication is roughly divided into three phases.
For bacteria:
Formation of pre-replication complex. DnaA binds to the origin recognition complex and separates the duplex. This attracts DnaB helicase and DnaC, which maintain the replication bubble. Formation of pre-initiation complex. SSB binds to the single strand and then gamma (clamp loading factor) binds to SSB. Formation of initiation complex. Gamma deposits the sliding clamp (beta) and attracts DNA polymerase III.
For eukaryotes:
Formation of pre-replication complex. MCM factors bind to the origin recognition complex and separate the duplex, forming a replication bubble. Formation of pre-initiation complex. Replication protein A (RPA) binds to the single stranded DNA and then RFC (clamp loading factor) binds to RPA. Formation of initiation complex. RFC deposits the sliding clamp (PCNA) and attracts DNA polymerases such as alpha (α), delta (δ), epsilon (ε).
For both bacteria and eukaryotes, the next stage is generally referred to as 'elongation', and it is during this phase that the majority of DNA synthesis occurs.
Separating the duplex
DNA is a duplex formed by two anti-parallel strands. Following Meselson-Stahl, the process of DNA replication is semi-conservative, whereby during replication the original DNA duplex is separated into two daughter strands (referred to as the leading and lagging strand templates). Each daughter strand becomes part of a new DNA duplex. Factors generically referred to as helicases unwind the duplex.
Helicases
Helicase is an enzyme which breaks hydrogen bonds between the base pairs in the middle of the DNA duplex. Its doughnut like structure wraps around DNA and separates the strands ahead of DNA synthesis. In eukaryotes, the Mcm2-7 complex acts as a helicase, though which subunits are required for helicase activity is not entirely clear. This helicase translocates in the same direction as the DNA polymerase (3' to 5' with respect to the template strand). In prokaryotic organisms, the helicases are better identified and include dnaB, which moves 5' to 3' on the strand opposite the DNA polymerase.
Unwinding supercoils and decatenation
As helicase unwinds the double helix, topological changes induced by the rotational motion of the helicase lead to supercoil formation ahead of the helicase (similar to what happens when you twist a piece of thread).
Gyrase and topoisomerases
Gyrase (a form of topoisomerase) relaxes and undoes the supercoiling caused by helicase. It does this by cutting the DNA strands, allowing it to rotate and release the supercoil, and then rejoining the strands. Gyrase is most commonly found upstream of the replication fork, where the supercoils form.
Protecting the leading and lagging strands
Single-stranded DNA is highly unstable and can form hydrogen bonds with itself that are referred to as 'hairpins' (or the single strand can improperly bond to the other single strand). To counteract this instability, single-strand binding proteins (SSB in prokaryotes and Replication protein A in eukaryotes) bind to the exposed bases to prevent improper ligation.
If you consider each strand as a "dynamic, stretchy string", the structural potential for improper ligation should be obvious.
The lagging strand without binding proteins. TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases =========================================== Sugar phosphate backbone
An expanded schematic reveals the underlying chemistry of the problem: the potential for hydrogen bond formation between unrelated base pairs. Schematic view of newly separated DNA strands without strand binding proteins. --HH--------HH-HH--H--HH----------HH--HH--H Hydrogen bond schematic HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Hydrogen bond schematic HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Hydrogen bond schematic TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases =========================================== Sugar phosphate backbone
Binding proteins stabilise the single strand and protected the strand from damage caused by unlicensed chemical reactions. The lagging strand coated with binding proteins (*) that prevent improper ligation. ******************************************* Strand binding proteins TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Lagging strand bases =========================================== Sugar phosphate backbone
The combination of a single strand and its binding proteins serves as a better substrate for replicative polymerases than a naked single strand (binding proteins provide extra thermodynamic driving force for the polymerisation reaction). Strand binding proteins are removed by replicative polymerases.
Priming the leading and lagging strands
From both a structural and chemical perspective, a single strand of DNA by itself (and the associated single strand binding proteins) is not suitable for polymerisation. This is because the chemical reactions catalysed by replicative polymerases require a free 3' OH in order to initiate nucleotide chain elongation. In terms of structure, the conformation of replicative polymerase active sites (which is highly related to the inherent accuracy of replicative polymerases) means these factors cannot start chain elongation without a pre-existing chain of nucleotides, because no known replicative polymerase can start chain elongation de novo.
Priming enzymes, (which are DNA-dependent RNA polymerases), solve this problem by creating an RNA primer on the leading and lagging strands. The leading strand is primed once, and the lagging strand is primed approximately every 1000 (+/- 200) base pairs (one primer for each Okazaki fragment on the lagging strand). Each RNA primer is approximately 10 bases long.
Single strand of DNA with strand binding proteins (*) and RNA primer added by priming enzymes (UAGCUAUAUAUA). =========================================== Sugar phosphate backbone ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Lagging strand bases UAGCUAUAUAUA******************************* RNA primer and strand binding proteins
The interface at (A*) contains a free 3' OH that is chemically suitable for the reaction catalysed by replicative polymerases, and the "overhang" configuration is structurally suitable for chain elongation by a replicative polymerase. Thus, replicative polymerases can begin chain elongation at (A*).
Primase
In prokaryotes, the primase creates an RNA primer at the beginning of the newly separated leading and lagging strands.
DNA polymerase alpha
In eukaryotes, DNA polymerase alpha creates an RNA primer at the beginning of the newly separated leading and lagging strands, and, unlike primase, DNA polymerase alpha also synthesizes a short chain of deoxynucleotides after creating the primer.
Ensuring processivity and synchronisation