The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome. In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes. The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five. It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats).
SARS-CoV-2 name length sequence location in virus genome location in human genome neighboring genes note HIS-SARS2-1 26 UGUCUAUGCUAAUGGAGGUAAAGGCU 7570–7595 in ORF1a Chr3: 124017420-124017395 KALRN HIS-SARS2-2 24 UAUAACACAUATAAAAAUACGUGU 12494–12517 in ORF1a Chr3: 176597319-176597342 HIS-SARS2-3 24 UUAUAUGCCUUAUUUCUUUACUUU 6766–6789 in ORF1a Chr5: 28949255-28949232 HIS-SARS2-4 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29860–29886 in 3' UTR Chr18: 73670168-73670142 FBXO15, , CYB5A same as HIS-SARS1-2 HIS-SARS2-5 24 UUGUUGCUGCUAUUUUCUAUUUAA 8610–8633 in ORF1a ChrX: 99693480-99693457
SARS-CoV-1 name length sequence location in virus genome location in human genome neighboring genes note HIS-SARS-1 25 UAACAUGCUUAGGAUAAUGGCCUCU 15251–15275 in ORF1b Chr4: 172887105–172887129Chr8: 122356667-122356690 HAS2, ZHX2 HIS-SARS-2 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29717–29743 in 3' UTR Chr18: 73670168-73670142 same as HIS-SARS2-4
MERS-CoV name length sequence location in virus genome location in human genome neighboring genes note HIS-MERS-1 24 UUCCAUUUGCACAGAGUAUCUUUU 24364–24387 in S ChrX: 25635779-25635802
HCoV-HKU1 name length sequence location in virus genome location in human genome neighboring genes note HIS-HKU1-1 24 UUAGAAUUGUUCAAAUGUUAUCUG 18656-18679 chr1:106816197-106816220 HIS-HKU1-2 24 UUUUCUAAGAAAGAUUGGUAUGAU 14044-14067 chr1:226438633-226438656chr4:151100495-151100518chr5:79284823-79284846chr5:111192947-111192970chr7:94695722-94695745chr7:98386489-98386512chr15:59768424-59768447chr22:30137367-30137390 HIS-HKU1-3 24 AUUUGACUUUAAAUCUUCAUACUA 26693-26716 chr4:11718458-11718481 HIS-HKU1-4 24 GAUUGGUUGUAUUUUCAUUUUUAU 23527-23550 chr4:33759646-33759669 HIS-HKU1-5 24 UAGAUACUGUUAUUUUUAAAAAUA 19844-19867 chrX:81711130-81711153
HCoV-NL63 name length sequence location in virus genome location in human genome neighboring genes note HIS-NL63-1 24 UUAUGAUUUUGGUGAUUUUGUUGU 13044-13067 chr1:215311768-215311791 HIS-NL63-2 24 GGUGUUUUUGUUGAUGAUGUUGUU 14920-14943 chr4:28254452-28254475 HIS-NL63-3 24 AUAGGCUUAAAUGCUUCUGUUACU 20754-20777 chr6:30469931-30469954 HIS-NL63-4 24 AAGUAAUUGUAUUAAGAUGUUAUC 12124-12147 chr7:19853545-19853568 HIS-NL63-5 24 AACUUUUAUGAUUUUGGUGAUUUU 13039-13062 chr9:1525276-1525299
HCoV-OC43 name length sequence location in virus genome location in human genome neighboring genes note HIS-OC43-1 24 UACAGCUCUUUGUAAAUCUGGUAG 22827-22850 chr8:122471006-122471029 HAS2, ZHX2 HIS-OC43-2 24 UUGUAUGAGUGAUUUUAUGAGUGA 24509-24532 chr13:30510223-30510246
HCoV-229E name length sequence location in virus genome location in human genome neighboring genes note HIS-229E-1 24 AAUAUUUUAACAGUACCACGUUAU 19817-19840 chr8:42865576-42865599 HIS-229E-2 24 ACUUUGUAUUGUGUCCUCCUGGAA 13139-13162 chr11:112451251-112451274
References